Amy (aranya_mx) wrote,

Guía Rápida para Escribir una Novela

Originally published at Vel Anima. You can comment here or there.

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma a el primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :) .


Tags: Opinión, en marcha, escritura, recursos, serie
  • Post a new comment


    default userpic

    Your reply will be screened

    Your IP address will be recorded 

    When you submit the form an invisible reCAPTCHA check will be performed.
    You must follow the Privacy Policy and Google Terms of use.